Protocol

Genotyping by Oligonucleotide Ligation Assay (OLA)

Department of Ecology and Evolutionary Biology, University of Kansas, Lawrence, Kansas 66045, USA
Department of Molecular Biosciences, University of Kansas, Lawrence, Kansas 66045, USA

Corresponding author (sjmac{at}ku.edu)

INTRODUCTION

This protocol describes the oligonucleotide ligation assay (OLA), which uses a set of three oligonucleotides, in combination with a thermostable Taq DNA ligase enzyme, to discriminate single-nucleotide polymorphism (SNP) alleles. Sixteen-plex OLA genotyping reactions are carried out, and allele-specific OLA products are detected on membrane arrays using radiolabeled probes.

MATERIALS

Reagents

Adenosine 5'-triphosphate (ATP) solution (100 mM; GE Healthcare, 27-2056-01)

Amplification buffer (10X) (500 mM KCl containing 1% Triton X-100)

A minimal amplification buffer is used because the amplification reagents are added directly to the OLA reaction, which already contains appropriate Tris-Cl and MgCl₂ concentrations for PCR.

[-³³P]ATP (250 µCi; Perkin Elmer, NEG602H250UC)

Denaturation solution

dNTPs (25 mM)

DTT (25 mM)

Herring sperm DNA, sonicated (10 µg/µL; Promega D1815)

OLA buffer, 10X

Oligonucleotides (also see Step 1 and Table 1):

M13F.BRL (50 µM): CCCAGTCACGACGTTGTAAAACG

M13R.BRL (50 µM): AGCGGATAACAATTTCACACAGG

OLA hybridization buffer (prewarmed to 42ºC)

Make fresh prior to each hybridization and filter-sterilize to remove any impurities that may bind to nylon membranes.

OLA neutralization buffer

OLA washing buffer, prewarmed to 40°C

PCR-amplified DNA samples containing the SNPs of interest

Stripping buffer (0.1% SDS), preheated to 80°C

T4 polynucleotide kinase (10 U/µL) and 10X buffer (New England Biolabs, M0201L)

Taq DNA ligase (40 U/µL; New England Biolabs, M0208L)

Taq DNA polymerase (5 U/µL; New England Biolabs, M0267L)

Because the amplified products are very small, almost any thermostable DNA polymerase can be used.

Equipment

Arrayer for nylon membranes (custom built)

See http://cstern.bio.uci.edu/tools/genotyping.htm for information about custom-built arrayers for nylon membranes.

Centrifuge with adaptors for microtiter plates

Equipment for running diagnostic gel (see Step 12)

Heating blocks at 37°C, 65°C, 80°C, 96°C

Hybridization oven preset to 42°C

Hybridization tubes

Image acquisition software package (e.g., GE Healthcare ArrayVision)

Laboratory gloves (powder-free)

Liquid-handling system (e.g., Art Robbins Instruments Hydra) (optional; see Step 7)

Manual pin-tool (optional; see Steps 8 and 15)

PCR plates (96-well or 384-well)

PCR thermocyclers (e.g., Applied Biosystems dual-block 384-well 9700)

Phosphor imager (e.g., GE Healthcare Typhoon)

Radioactive waste container

Repeater pipette (optional; see Step 7)

Shaking platform

Software for genotype analysis

The free statistical programming package R is available at www.r-project.org/. Custom genotype-calling software for R is available at http://cstern.bio.uci.edu/tools/genotyping.htm.

Storage phosphor screens (e.g. GE Healthcare 63-0034-82)

Ultraviolet (UV) cross-linker (50 mJ)

Water baths at 40°C, 80°C

METHOD

An overview of the genotyping pipeline is given in Figure 1 .

View larger version (16K): [in this window] [in a new window]

Figure 1. The OLA genotyping pipeline.

Generation of OLA Genotyping Oligonucleotides

1. For each SNP of interest, design two upstream allele-specific oligonucleotides (47 nucleotides [nt]) and a single common downstream oligonucleotide (31 nt) as follows:

• Upstream_a: M13F + C + Barcode_a + Up_flank + Allele_a
  
  
• Upstream_b: M13F + C + Barcode_b + Up_flank + Allele_b
  
  
• Downstream: Down_flank + G + M13R.RC
  Sections of the OLA genotyping oligonucleotides are:
  
  
• M13F: GACGTTGTAAAACG
  
  
• M13R.RC: CCTGTGTGAAATTG
  
  
• A "C" or "G" nucleotide adjacent to the M13 sequence ensures that multiple ligated products of different sequence are evenly amplified.
  
  
• "Barcode_a" and "Barcode_b": These are the 16-nt bar code sequences permitting allele discrimination during hybridization shown in Table 1. Sixteen pairs are available, permitting 16-plex OLA reactions--one pair of bar codes/probes per SNP in the reaction.
  
  
• "Up_flank" and "Down_flank": These are 15 nt and 16 nt, respectively, and specific to the region upstream and downstream of the target SNP, respectively. If either of these flanking regions segregates for an additional SNP, the oligonucleotide sequence at those sites can incorporate a degenerate base.
  
  
• "Allele_a" and "Allele_b": These represent the allele at the target SNP.
  
  

2. Synthesize the unmodified genotyping nucleotides (from Step 1) at the lowest synthesis scale, and dilute each of them to a concentration of 100 µM.

3. Create a 1-µM 16-plex upstream OLA oligonucleotide mix by mixing 2 µL of each of the 32 upstream oligonucleotides (at 100 µM) with 136 µL of H₂O.

4. Independently 5'-phosphorylate the downstream oligonucleotides.

i. For each 12.5-µL reaction, use:

H2O 8.125 µL T4 polynucleotide kinase buffer (10X) 1.25 µL ATP (100 mM) 0.125 µL T4 polynucleotide kinase (10 U/µL) 1 µL Downstream oligonucleotide (100 µM) 2 µL

ii. Incubate these reactions for 1 h at 37°C.

iii. Stop the reactions by incubating for 20 min at 65°C.
Phosphorylation is required so that up- and downstream oligonucleotides can be ligated, and should not be performed en masse (interactions among oligonucleotides can prevent equal phosphorylation of each oligonucleotide).

5. Create a 1-µM 16-plex downstream OLA oligonucleotide mix by mixing together 12 µL of each of the 16 downstream oligonucleotide phosphorylation reactions.

OLA Reaction

6. Make up the following reagent mix (3 µL/reaction) for a sufficient number of samples:

H2O 2.3 µL OLA buffer (10X) 0.3 µL DTT (25 mM) 0.3 µL Taq DNA ligase (40 U/µL) 0.04 µL Upstream oligonucleotide mix (from Step 3) 0.03 µL Downstream oligonucleotide mix (from Step 5) 0.03 µL

7. Add 3 µL of the reagent mix to each well of a 384- or 96-well PCR plate, using a repeater pipette or a liquid-handling robot.

8. Use a liquid-handling robot or a manual pin-tool to spike the reactions with 0.2 µL of PCR-amplified DNA containing the SNPs of interest.
Consistency among samples is reduced with a pin-tool.
Some of the PCR samples should be no-DNA PCR blanks as controls.

9. Seal the plate(s) and centrifuge briefly. Perform ligation using the following cycling profile:

Number of cycles Denaturation Ligation 1 5 min at 95°C 3 30 sec at 95°C 25 min at 45°C

After this step, the samples can be stored at 4°C.

OLA Amplification Reaction

10. Make up the following reagent mix (12 µL/reaction) for a sufficient number of samples:

H2O 10.196 µL Amplification buffer (10X) 1.2 µL dNTPs (25 mM) 0.024 µL Taq DNA polymerase (5 U/µL) 0.1 µL M13F.BRL (50 µM) 0.24 µL M13R.BRL (50 µM) 0.24 µL

11. Add 12 µL of reagent mix directly to each OLA ligation reaction (from Step 9), seal the plate(s), and centrifuge briefly. Amplify the ligation products using the following cycling profile:

Number of cycles Denaturation Annealing Extension 1 2 min at 94°C 32 25 sec at 94°C 35 sec at 58°C 35 sec at 72°C 1 2 min at 72°C

After this step, the samples can be stored at 4°C.

12. Run both control (no-DNA PCR) and positive samples on a diagnostic gel: A bright band (78 bp) should be visible in the positive samples, and not in the blank controls.
Because the concentration of M13 primer in the OLA amplification reactions is very high, blanks normally contain an accessory "primer-dimer" band that is smaller than the positive band.

Arraying

13. Dry down the OLA amplification reactions at 65°C in a thermocycler for ~1 h.

14. Add 5 µL of denaturation solution to each well, and resuspend/denature the samples in the thermocycler using this profile:

Step Resuspension Denaturation 1 15 min at 65°C 2 5 min at 95°C

15. Print samples onto nylon membranes using an arraying robot. Wear powder-free laboratory gloves, and do not touch membranes with bare hands. Allow the membrane spots to dry for 10 min.
A manual pin-tool can be used to print samples, although spot quality suffers.

16. UV-cross-link the samples at 50 mJ, and gently shake the membranes in a bath of neutralization buffer for 30 min (to neutralize the high pH of the denaturing print solution).

Hybridization

17. Add membrane(s) to the hybridization tube (multiple membranes can be stacked in a single tube). Add 5 mL of prewarmed (42°C) hybridization buffer and 50 µL of sonicated herring sperm DNA that has been denatured by incubation for 5 min at 96°C.

18. Rotate the tube in a hybridization oven at 4 rpm overnight (for the first use of the membranes) or for 3 h (for all subsequent hybridizations) at 42°C.

19. Prepare a radiolabeled oligonucleotide probe.

i. End-label the oligonucleotide (see Table 1) with [-³³P]ATP in the following 10-µL reaction:

H2O 5 µL T4 polynucleotide kinase buffer (10X) 1 µL Probe oligonucleotide (10 µM) 1 µL T4 polynucleotide kinase (10 U/µL) 1 µL [-33P]ATP (10 µCi/µL) 2 µL

ii. Incubate this reaction for 40 min at 37°C.

iii. Stop the reaction by incubating it for 15 min at 80°C.
It is not necessary to column- (or otherwise) purify this reaction before use.

20. Add the radiolabeled probe reaction to the hybridization tube, and rotate the tube in a hybridization oven at 4 rpm for 4 h at 42°C.

Washing

21. Empty the hybridization buffer/radiolabeled probe to waste. Briefly rinse the tube with a small quantity of washing buffer (prewarmed to 40°C), and also discard this to waste.

22. Add 50 mL of prewarmed (40°C) washing buffer. Rotate the tube at 4 rpm for 20 min at 40°C, and discard the buffer to waste. Perform three to five of these wash cycles.
The number of wash cycles required will depend on the number of filters hybridized per tube. Too few wash cycles will lead to an inconsistent background level of radiation across the membrane surface.

23. Remove the membranes from the hybridization tube and rinse in a bath of prewarmed washing buffer at 40°C.

Data Collection

24. Expose the hybridized/washed membranes to a phosphor screen for 3-4 d. Scan the screen using a phosphor imager.
The actual exposure time required will depend on the spot intensity of the hybridized membranes.

25. Analyze the images with an image acquisition software package (e.g., GE Healthcare ArrayVision). Call genotypes using custom software (http://cstern.bio.uci.edu/tools/genotyping.htm) available for the free statistical programming package R (http://www.r-project.org/).

Stripping

Once membranes have been imaged, they must be stripped prior to being reprobed.

26. Move membranes from the phosphor screen cassette to a bath of neutralization buffer to ensure that they stay moist.
If membranes dry out while radiolabeled probe is bound, the probe can become permanently fixed to the membranes.

27. Add the membranes to hybridization tubes with 50 mL of stripping buffer preheated to 80°C. Rotate the tubes at 4 rpm for 15 min at 80°C.

28. Discard the buffer to waste, and either store the membranes at 4°C in neutralization buffer, or start the protocol again from Step 17.